Investigations
| Examination | Value | Normal limits at 5 months |
|---|---|---|
| WBC | 8.9 | (6.0-17.5 x10 9 cells/L) |
| Neutrophils | 2.6 | (1.0-8.5 x10 9 cells/L) |
| Lymphocytes | 4.2 | (3.4-9.5 x10 9 cells/L) |
| Monocytes | 1.0 | (0.2-1.2 x10 9 cells/L) |
| Basophils | 0 | (<0.11 x10 9 cells/L) |
| Eosinophils | 1.1 | (<0.8 x10 9 cells/L) |
| Hb | 98 | (114-141 g/L) |
| MCV (Mean corpuscular volume) | 95 | (80-96 f/L) |
| Reticulocyte count | 11.2 | (0.8-4% of RBC) |
| Platelets | 235 | (150-400 x10 9 u/L) |
| LDH (Lactate Dehydrogenase) | 735 | (70-250 u/L) |
| Haptoglobin (free serum) | 2 | (27-139 mg/dl) |
| Bilirubin unconjugated | 2.3 | (<1.0 mg/dL) |
| Alanine aminotransferase | 14 | (6-50 U/L) |
| Aspartate aminotransferase | 23 | (20-60 U/L) |
| Alkaline phosphatase | 214 | (110-320 U/L) |
| γ -Glutamyl transferase (GGT) | 52 | (34-263 U/L) |
| INR (international normalized ratio) | 1.0 | (0.8-1.2) |
| CRP (C-Reactive Protein) | 17 | (0-8 mg/l) |
| Sodium | 146 | (135-147 mmol/L) |
| Potassium | 3.2 | (3.3-5.0 mmol/L) |
| Chloride | 99 | (99-103 μmol/L) |
| Urea | 10.8 | (2.5-6.4 mmol/L) |
| Creatinine | 98 | (62-115 mmol/L) |
| Total protein | 66 | (60-80 g/L) |
| Albumin | 37 | (35-50 g/L) |
| Corrected calcium | 2.3 | (2.1-2.6 mmol/L) |
| Phosphate | 1.0 | (1.0-1.5 mmol/L) |
| Magnesium | 0.8 | (0.8-1.3 mmol/L) |
| Cortisol | 18 | (2.8-23 μg/dL) |
| Thyroid stimulating hormone | 11.3 | (9-30 mIU/L) |
| Free T4 | 14.2 | (10-26 pmol/L) |
| C3 complement | 0.9 | (0.5-1.53 g/L) |
| C4 complement | 0.8 | (0.2-1 g/L) |
| Cytometric analysis of peripheral blood mononuclear cells | ||
| CD3 + | 70%; 3.8 x10 9 /L | (49-77%; 1.90-5.90 x10 9 /L) |
| CD3 + CD4 + | 45%; 2.4 x10 9 /L | (31-56%; 1.4-4.3 x10 9 /L) |
| CD3 + CD8 + | 25%; 1.4 x10 9 /L | (12-24; 0.5-1.7×10 9 /L) |
| CD19 + | 21%; 1.1 x10 9 /L | (11-41; 0.43-3.0×10 9 /L) |
| NK CD3-/CD16+ | 9%; 0.5 x10 9 /L | (3-15; 0.16-0.95×10 9 /L) |
| IgE | 980 | (<15 IU/mL) |
| Antinuclear antibodies | Positive (homogeneous) | |
| Anti-pancreatic islet autoantibodies | Positive | |
| Anti-glutamic acid decarboxylase (anti-GAD65) | Positive | |
| Anti-insulin autoantibodies | Positive | |
| Direct Coombs test | Positive | |
| Anti-enterocyte KD75 autoantibodies | Positive | |
| Anti-smooth muscle autoantibodies | Positive | |
| 21-hydroxylase autoantibodies | Negative | |
EKG: normal
Upper gastrointestinal endoscopy with duodenal biopsy:
- normal visual aspect
- total villous atrophy and dense infiltrate of plasma cells and T cells
Figure 1: Duodenal biopsy
Figure 2: Analysis of CD4+ cells by flow cytometry
Figure 3: Sequencing of the transcription factor FOXP3 (Forkhead box protein P3) gene: hemizygous missense mutation in FOXP3 gene: c.1016 C>A, ( p.P339H)
Wild-type sequence: ACCCCCTTTCACCTACGCCACGC
Mutated sequence: ACCCCATTTCACCTACGCCACGC
Conclusion of investigations:
- normocytic anaemia with positive Coombs test: autoimmune haemolytic anaemia
- platelet and white cell count: normal
- ion and renal parameters: stigmata of dehydration with mild functional renal failure
- cortisol and thyroid: normal
- dosage of complement: normal
- immunoglobulins: hyperIgE
- anti-islet, anti-GAD65 and anti-insulin autoantibodies: autoimmune (type 1) diabetes mellitus
- villous atrophy and intestinal inflammatory infiltrate, anti-enterocyte KD75 autoantibodies, persistent watery diarrhoea: autoimmune enteropathy
- counts of CD3+CD4+ T cells, CD3+CD8+ T cells and B cells: normal
- count of CD4+/CD25hi/FOXP3+ T cells: < 0.1%
- count of CD25+/CD127low T cells: < 0.1%
- hemizygous mutation in FOXP3
